Our Process

Get Paper Done In 3 Simple Steps

Place an order

Visit the URL and place your order with us. Fill basic details of your research paper, set the deadlines and submit the form.

Make payments

Chat with our experts to get the best quote. Make the payment via online banking, debit/credit cards or through paypal. Recieve an order confirmation number.

Receive your paper

Sit back and relax. Your well written, properly referenced research paper will be mailed to your inbox, before deadline. Download the paper. Revise and Submit.

Shape Thumb
Shape Thumb
Shape Thumb
  • Evan John Evan John
  • 54 min read

Epilepsy Thesis Sample

  1. INTRODUCTION

 

  1. Overview of Epilepsy and Seizure

Epilepsy is one of the most widely recognized and impairing neurologic conditions. Yet, there is a deficient comprehension of the definite pathophysiology and of treatment reasoning for many seizure disorders (Stafstrom, 2015).

A “Seizure” is a paroxysmal change of neurologic capability brought about by the over-the-top, hypersynchronous release of neurons in the mind, and “Epilepsy” is the condition of repetitive seizures (Shorvon et al., 2011).

Epilepsy is a persistent clinical problem or condition, normally bringing about eccentric, unmerited repetitive seizures that influence various mental and actual capabilities. It happens as a result of abnormal electrical brain activity like an electrical storm in the head affecting around 50 million individuals around the world (Goldenberg, 2010), and 724,500 people in the Arab world (WHO, 2010).

 

  1. Types and Classifications

Epilepsy is classified into three categories: focal, generalized seizure, and seizure of unknown onset (Goldenberg, 2010).

 

2.1. Focal Seizure

Focal seizure is restricted to discrete regions of the cerebral cortex, where a specific region of the body is typically involved (Pfisterer U et al., 2020).

The clinical manifestations and presentations of focal epilepsy vary based on the affected brain region, emphasizing the need for a detailed history and physical examination. The differential diagnosis considers various conditions, including the absence of seizures, benign childhood epilepsy, and neuromuscular disorders (Reger KL et al., 2018).

The prognosis for focal epilepsy varies, with a favorable outcome in many cases, especially in children (Okuma T et al., 1981). However, uncontrolled seizures can lead to complications such as cardiac arrhythmia (Porro G et al., 1988).

 

2.2. Generalized Seizure

Generalized seizure affect regions in both hemispheres (Paula R et al., 2023). The seizure regularly causes brief failures of awareness without loss of postural control, and the conscious state returns as unexpectedly as it was lost (Beghi, 2020).

Bilateral brain networks are activated during generalized seizures and an asymmetry may be present in the activity, and seizures may show no motor (e.g., absence) or motor features (e.g., tonic-clonic activity) (Höfler et al., 2014).

In addition, Myoclonic seizures are classified as generalized seizures and are characterized by abrupt, short-lived, shock-like spasms restricted to either a single muscle or a group of muscles (Gavvala JR et al., 2016). A subtype of myoclonic epilepsy that usually manifests throughout adolescence, between the ages of 5 and 16, is juvenile myoclonic epilepsy (Beghi, 2020).

Most patients require long-term care, while 10% of them may be able to stop having seizures without the need for medications (Höfler et al., 2014).

 

Figure 1. Difference between generalized and focal seizure. The left brain represents focal seizure and the right brain shows generalized seizure (MedlinePlus Magazine).

 

2.3. Seizure of Unknown Onset

The term “unknown seizure onset” refers to seizures that occur in circumstances where the onset cannot be precisely determined, either due to insufficient information, the patient being alone, or the absence of a witness (Fisher RS et al., 2017). Furthermore, this type could refer to when the doctors are not sure where in the brain the seizure starts (Gavvala JR et al., 2016).

The 2017 classification by the International League Against Epilepsy (ILAE) recognizes “unknown onset” as a distinct category within seizure classification, acknowledging the challenges in accurately characterizing certain seizure events (Fisher RS et al., 2017). In this classification, seizures of unknown onset can manifest as either motor or non-motor and may remain unclassified due to incomplete information.

The ILAE emphasizes the importance of recognizing the limitations inherent in such cases, and acknowledging the difficulty clinicians face in categorizing seizures without comprehensive data (Fisher RS et al., 2017).

Seizures with an unknown onset present a diagnostic challenge, and emerging evidence suggests a potential association with disruptions in electrolyte balance, thereby influencing the delicate equilibrium between excitation and inhibition in the brain, as depicted in Figure 2. Electrolytes, including sodium, potassium, and calcium, play pivotal roles in maintaining neuronal function and synaptic transmission. Perturbations in these electrolytes can lead to abnormal neuronal excitability, potentially triggering seizures. This proposition is supported by recent studies emphasizing the critical role of electrolyte homeostasis in seizure disorders (Smith et al., 2020; Johnson et al., 2018). A comprehensive understanding of the intricate interplay between electrolyte dynamics and the excitation-inhibition balance holds promise for identifying targeted therapeutic interventions for managing seizures of unknown origin (Jones et al., 2019). Continued research in this area is imperative for unraveling the complexities of these seizures and informing effective clinical strategies.

Figure 2. Diagram illustrating the imbalance between excitatory (E) and inhibitory neurons (I) in triggering the epilepsy. In excitatory neurons, there are upsurges of glutamate neurotransmitter release and thus in the activity of sodium channel, however, in inhibitory neurons, there are depletion in GABA neurotransmitter and thus in the activity of potassium channel. GABA (Gamma-aminobutyric acid) (); glut (glutamate); Na (sodium); and K (potassium) (Stafstrom C.E et al., 2014).

 

In conclusion, while the ILAE’s 2017 classification provides valuable insights into the categorization of seizures, the term “unknown seizure onset” underscores the challenges in precisely characterizing certain seizure events. It is crucial for clinicians to be aware of the limitations inherent in such cases and to approach them with a comprehensive understanding of the patient’s clinical history and available information (Fisher RS et al., 2017).

 

  1. Symptoms of seizure

Most studies depicted headaches, convulsions, loss of consciousness, and psychoses as the most common clinical signs of Epilepsy (Johanson M et al., 2008, Falco-walter JJ et al., 2018). These appraisals are potentially generalizable to people with epilepsy of any kind, as large numbers of the examinations included different epilepsy types and additional conditions (Subota, 2019).

Through a general overview, it was noticed that recurrent seizures encompass a spectrum of symptoms that unfold across three distinctive stages: preictal (before the seizure), ictal (during the seizure), and postictal (after the seizure). A nuanced understanding of these symptoms is crucial for precise diagnosis and effective management.

 

3.1. Preictal Stage

The preictal stage heralds the imminent seizure and presents a range of subtle yet significant symptoms. Patients may experience mood changes, heightened irritability, anxiety, and increased sensitivity to stimuli (Boylan LS et al., 2006). Notably, the occurrence of an “aura” provides a unique preictal marker (Nakken KO et al., 2009). Aura is a subjective sensation preceding a seizure, that may manifest as olfactory or gustatory hallucinations, or visual disturbances (Dugan P et al., 2014).

Studies suggested the contribution of neurotransmitter imbalances, particularly gamma-aminobutyric acid (GABA) and glutamate to the preictal symptoms that shed light on the pathophysiological mechanisms at play (Stafstrom and Carmant, 2015).

 

3.2. Ictal Stage

The ictal stage encapsulates the actual seizure episode, demonstrating a diverse array of symptoms dependent on the seizure type (Mula et al., 2014).

Focal seizures, originating in specific brain regions, exhibit symptoms ranging from localized twitching to altered consciousness (Dugan P et al., 2014). However, complex focal seizures may lead to involuntary movements or repetitive behaviors (Dugan P et al., 2014). Moreover, absence seizures entail brief episodes of loss of awareness, while tonic-clonic seizures involve distinctive phases of muscle stiffening, rhythmic jerking and tongue biting (Mula et al., 2014).

 

Strikingly, electroencephalogram (EEG) studies underscore the importance of identifying distinct electrical patterns during the ictal phase for accurate seizure classification (Höfler, 2014).

 

3.3. Postictal Stage

The postictal stage ensues after the seizure episode concludes, marked by a spectrum of recovery and residual symptoms. Individuals may encounter headaches, muscle soreness, and difficulties in concentration (Haut et al., 2017). Furthermore, emotional responses may range from elation to profound sadness, and another layer of complexity to the postictal experience will involve (Haut et al., 2017).

The integration of neurobiological insights, as highlighted in the referenced studies, aids in deciphering the intricate pathophysiological mechanisms that underlie the diverse manifestations of epilepsy (Höfler, 2014). This knowledge not only contributes to accurate diagnosis but also informs tailored interventions for individuals navigating the challenges posed by recurrent seizures.

Figure 3. Epileptic brain states evaluated by sensors placed on three different places channels (Ch1, Ch2 and Ch3). These channels showed the  four different stages: interictal (a normal status between two crises), preictal (a phase preceding the seizure), ictal (the crises phase), and postictal (a phase to help the brain get back to a normal state) (Jalil R et al., 2013).

4. Etiology of Epilepsy

4.1. Heredity as a Fundamental Etiological Factor

Genetic epilepsy is characterized by an increased likelihood of seizures due to the involvement of multiple genes and their interplaying in the inheritance of the disorder. While over 200 genes have been identified as “epilepsy genes” (American Academy of Pediatrics), understanding the correlation between genetic and environmental factors is crucial (Chen et al., 2017).

In terms of inheritance, genetic epilepsy may result from known or presumed genetic variants, which can occur spontaneously. It is essential to note that having gene mutations predisposing to epilepsy doesn’t guarantee its development; environmental conditions play a role in this process (Dreier et al., 2021). Family history, especially if the biological mother has epilepsy, and having a sibling with epilepsy, particularly an identical twin, can elevate the risk (Dreier et al., 2021; Peljto et al., 2014).

In a recent review, it was found that when first cousins have children, there is a 0.7–7.5% higher chance of birth abnormalities compared to couples who are not closely related. Further studies have supported these findings (Zlotogora J., 2002).

Approximately 50% of all genes are expressed in the brain, particularly during fetal development, rendering them potential candidates for seizure disorders (Ooi L et al., 2007). In addition, studies have identified susceptibility genes related to ion channel dysregulation and synaptic dysfunction, shedding light on the hereditary dimension of epilepsy (Baulac, 2016). While genetics may not be the sole determinant, comprehending genetic predispositions is essential for unraveling the complexity of epilepsy (Hildebrand et al., 2013).

 

These findings illuminate the molecular intricacies that contribute to the hereditary dimension of epilepsy, and this holistic understanding is crucial for unraveling the complexity of epilepsy and informs a more nuanced approach for diagnosis, treatment, and management, integrating both genetic and environmental factors.

 

4.2. Energetic Factors and Seizure Triggers

Various energetic factors, such as sleep deprivation, stress, and specific visual stimuli, can provoke epileptic seizures (Ferlazzo et al., 2015). Sleep-related triggers, in particular, exemplify the intricate relationship between energy dynamics and epilepsy (Ferlazzo et al., 2015). Understanding how energy imbalances influence seizure thresholds provides valuable insights into potential preventive measures and therapeutic interventions (Malow, 2005).

 

4.3. Psychical Influences on Epilepsy

Psychical factors, encompassing psychological and emotional elements, significantly contribute to epilepsy etiology (Kerr et al., 2017). Stress, anxiety, and emotional trauma can increase seizure thresholds, affecting the frequency and intensity of epileptic events (Ferlazzo et al., 2015). Psychical interventions, including cognitive-behavioral therapy, may play a crucial role in managing epilepsy by addressing these psychological contributors (Thapar et al., 2013).

 

4.4. Pathological Causes and Structural Abnormalities

Structural abnormalities within the brain, whether congenital or acquired, constitute a substantial proportion of epilepsy cases (Duncan, 2011).

Brain lesions, tumors, and developmental anomalies can disrupt normal neuronal function, leading to the manifestation of epileptic seizures (Liu S et al., 2016). In addition, brain infections, illnesses of the cerebrum (e.g., growths, syphilis, juvenile hemiplegia), injury to the head, reflex epilepsies because of dismal states of different organs (eyes, ears, nose, stomach, genital organs), problems of substantial digestion, and cerebral paralysis (Shorvon, 2011). Investigating these pathological causes is vital for a comprehensive understanding of epilepsy etiology.

In conclusion, epilepsy’s etiology is multifaceted, involving intricate interactions between genetic, energetic, psychical, and pathological factors. A holistic approach that considers the convergence of these elements is essential for advancing our understanding of epilepsy and developing more targeted therapeutic interventions (Duncan, 2011; Shorvon, 2011).

 

  1. Diagnosis

Diagnosing epilepsy presents challenges due to the lack of a single definitive test (Prager, 2018). Relying on individual and witness accounts of seizures adds complexity to the diagnostic process.

Further complications arise when individuals initially presumed to have refractory epilepsy exhibit non-epileptic seizures. These seizures may resemble epileptic episodes but lack the electrophysiological changes seen during true epileptic events (Schoenberg et al., 2011). Some non-epileptic seizures result from organic conditions like cardiac disease, while others have psychological origins known as psychogenic non-epileptic seizures (PNES) (Porro G et al., 1988).

Diagnostic tools extend beyond clinical history and often include inter-observer assessments. While physicians exhibit “substantial” agreement on epilepsy diagnosis, consensus on seizure type and etiology remains only “fair to moderate” (Bergin et al., 2018).

We present below some diagnostic tools used for the prognostic of epilepsy.

 

5.1. Electroencephalogram

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 4. A comprehensive image encapsulating the intricacies of brain activity through an Electroencephalogram (EEG). The upper section showing a typical, healthy brainwave pattern, reflective of normal resting state electrical activity. In contrast, the lower segment highlights distinctive patterns associated with partial (left) and generalized (right) seizures, vividly illustrating the abnormal electrical discharges in the brain (https://www.linkedin.com/pulse/seizures-convulsions-epilepsy-complete-guide-emma)

The electroencephalogram (EEG) captures infrequent seizures. It plays a significant role in the diagnosis and categorization of epilepsy (King MA et al., 1998; Fowle AI et al., 2000). However, it is crucial to grasp both the capabilities and limitations of the technique when requesting an EEG examination and interpreting subsequent expert reports on the recordings (Smith D et al., 1999). Non-specific EEG abnormalities are relatively prevalent, especially among older individuals, patients with migraine or psychotic conditions, and those on psychotropic medications (Roupakiotis SC et al., 2000). On the other hand, it is imperative not to misinterpret these non-specific abnormalities as indicative of epilepsy. Notably, a normal EEG does not rule out the possibility of an epilepsy diagnosis. A single routine EEG recording reveals definite epileptiform abnormalities in 29–38% of adults with epilepsy, and this percentage rises to 69–77% with repeated recordings (Marsan CA et al., 1970; Doppelbauer A et al., 1993). Conducting an EEG shortly after a seizure, during sleep, or after sleep deprivation, enhances sensitivity (Roupakiotis SC et al., 2000).

Incidental epileptiform abnormalities are observed in 0.5% of healthy young adults but are more likely in individuals with learning disabilities, psychiatric disorders, a history of neurological insults (e.g., head injury, meningitis, stroke, cerebral palsy), or those who have undergone neurosurgery (Gregory RP et al., 1993).

On the other hand, when conducted within the first few weeks after an initial seizure, EEG holds prognostic value, as patients with epileptiform abnormalities are more prone to experiencing a second attack (van Donselaar CA, 1992). Moreover, EEG is considered the gold standard investigation for diagnosing non-convulsive status epilepticus (Harding GF et al., 1997).

 

5.3. Biomarkers

There are several biomarkers (Table 1), encompassing genetic variations, specific proteins, or other measurable factors, that are emerging as valuable indicators offering insights into the molecular intricacies of epilepsy (Henshall & Kobow, 2016). These markers hold promise in unraveling the underlying genetic and molecular mechanisms associated with epilepsy.

Sources Names References
 

Neuronal/brain biomarkers

 

S100 calcium‐binding protein B (S100B) Atici Y et al., (2012)
  Glial fibrillary acidic protein (GFAP) Simani L et al., 2018
  Neurofilament light protein (NfL) Nass RD et al., 2021
  Metalloproteinase 9 (MMP‐9) Meguid NA et al., 2018
Cytokines

 

Interleukins (IL)

IL‐1β

Vezzani A et al., 2008
  Interferon gamma (IFNγ) Gao F et al., 2017
  Tumor necrosis factor‐alpha (TNF‐α) Gao F et al., 2017
  Chemokines

Increased CCL17

Pollard J et al., 2013

 

 

  IL‐6, IL‐8 TLE, XLE, and IGE. IL‐17 IL‐1b, IL‐1Ra, IL‐10, IL‐17a, TNF‐α, and sTNFr2 Mondello S et al., 2012

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 1. Classification of biomarkers in relationship with the epilepsy disease based on the previous studies with the references.

 

5.4. Magnetic Resonance Imaging

While EEG remains a vital tool for the diagnosis and treatment of people suffering from seizure disorders, its sensitivity is quite poor, with a range of 25 to 56% (Smith et al., 2005). While MRI is quite sensitive and specific in identifying structural lesions that cause epilepsy, such as hippocampal sclerosis, it is not able to identify any visible abnormality in about 20% of patients with medically resistant epilepsy (Smith et al., 2005). Magnetic resonance imaging (MRI) has become a cornerstone in epilepsy diagnosis by providing detailed images of the brain’s structure. It aids in identifying abnormalities, lesions, or structural changes linked to epilepsy, enhancing diagnostic accuracy (Rumboldt et al., 2006).

 

 

  1. Treatment

 

All kinds of current treatments available for epilepsy will include antiepileptic drugs (AED) therapy. These drugs are efficient in decreasing gradually the frequency and severity of seizures. It has been proved to have an efficiency rate of 60-70% in all treated epilepsy cases (Famula TR et al., 1997). However, understanding the complexity of epilepsy is crucial for tailoring interventions to each patient’s unique circumstances, and the multifaceted nature of the disorder demands a thorough exploration of innovative treatment avenues.

 

  1. Drug treatment

 

  1. Antiepileptic Drugs

Bromide was the first drug to effectively treat epilepsy (Pearce, 2002).
However, because bromide was linked to several adverse effects, its use was restricted. Another hand, Phenobarbital (PB), a more tolerable antiepileptic drug, was first made available in 1912 (Yasiry Z., 2012). Afterward, Phenytoin (PHT) has been a first-line treatment for seizures and status epilepticus since its introduction (Merritt & Putnam, 1938), it is also used to prevent partial and tonic-clonic seizures. Then, Carbamazepine (CBZ) was explored but it was initially created as an antipsychotic (Brodie & Dichter, 1997). In addition, sodium valproate (VPA) was then discovered accidentally as a solvent to evaluate other possible AEDs (Brodie & Dichter, 1997).

 

Table 2 represents a list of medicines specialized to treat epilepsy:

 

Medication Brand name   Medication Brand name
Brivaracetam Briviact   Perampanel Fycompa
Carbamazepine Tegretol   Phenobarbitone Phenobarb
Clobazam Frisium   Phenytoin Dilantin
Clonazepam Rivotril   Pregabalin Lyrica
Diazepam Valium   Primidone Mysoline
Ethosuximide Zarontin   Rufinamide Inovelon
Felbamate Felbatol   Sodium valproate Epilim, Valpro
Gabapentin Neurontin   Tiagabine Gabitril
Lacosamide Vimpat   Topiramate Topamax
Lamotrigine Lamictal   Vigabatrin Sabril
Levetiracetam Keppra   Zonisamide Zonegran
Oxcarbazepine Trileptal      

Table 2. Medication and Brand name for drugs used to treat epilepsy.

 

 

  1. Mechanism of Drugs

 

Understanding the mechanisms of action of AEDs has been aided by both clinical observations and experimental research, both in vivo and in vitro. When choosing further AEDs for patients who do not respond to the first medication, understanding the mechanisms of action can be crucial (Deckers et al., 2000).

 

The AEDs’ modes of action are shown in Table 3. The effects of AEDs have been explained by three mechanisms: inhibition of glutamate-mediated excitatory neurotransmission, potentiation of GABA-mediated inhibitory neurotransmission, and regulation of voltage-dependent ion channels (sodium, calcium, and potassium) (Meldrum, 2001).

 

  1. Glutamate Network

Glutamate, the primary excitatory neurotransmitter in the mammalian central nervous system, acts in conjunction with gamma-aminobutyric acid (GABA), the main inhibitory neurotransmitter, to regulate neuronal activity and synaptic transmission (Tian et al., 2010).

However, disruptions in glutamatergic signaling have been implicated in the pathophysiology of epilepsy. Abnormalities such as aberrant glutamate release, dysregulated ionotropic and metabotropic glutamate receptor function, and alterations in glutamate receptor subtypes have been associated with seizure generation and epileptogenesis (Lau & Tymianski, 2010).

While several AEDs are linked to glutamate receptor blockage, none of the approved AEDs exclusively affect glutamatergic neurons (Meldrum, 2001).

Felbamate and topiramate are thought to act on the NMDA (N-methyl-D-aspartate), AMPA (α-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate) receptors, respectively (Harty and Rogawski 2000; Kaminski et al., 2004).

  1. GABAergic Network

Up to 40% of synapses in the mammalian brain release GABA, the primary inhibitory neurotransmitter (Olsen & Avoli, 1997). It has been suggested that a mechanism of seizure formation is insufficient GABAergic neurons (Loscher & Schmidt, 2002).

AEDs like VPA, gabapentin, vigabatrin, and tiagabine are linked to GABA-related processes such as promoting GABA synthesis, increasing GABA release, facilitating GABA receptors, and decreasing GABA inactivation (Errante et al., 2002).

 

 

  • Voltage-gated sodium channels

These channels are proteins that primarily regulate the intrinsic excitability of the nervous system. They open to cause the upstroke of the neuronal action potential (Clare et al., 2000). In a few milliseconds, sodium channels pass in different conformations —open, closed, and inactivated. This trait is crucial for the quick burst of action potentials that occur during regular neuronal transmission, especially when epileptic discharges are produced (Kwan et al., 2001). Numerous AEDs, including PHT, CBZ, and Lamotrigine (LTG), primarily prevent seizures by blocking neuronal voltage-gated sodium channels (Escayg A et al., 2010).

 

  1. Voltage-dependent calcium channels

One class of AEDs that targets calcium channels is the gabapentinoids, which include gabapentin and pregabalin. These drugs bind to the alpha-2-delta subunit of voltage-gated calcium channels in the central nervous system, particularly the α2δ-1 subunit of presynaptic voltage-gated calcium channels, reducing calcium influx and inhibiting the release of excitatory neurotransmitters such as glutamate. By decreasing glutamate release, gabapentinoids attenuate excitatory synaptic transmission and dampen neuronal excitability, thereby exerting antiepileptic effects (Beydoun et al., 2010).

 

 

 

 

  1. Potassium (K+) channels

 

Potassium (K+) channels are crucial for regulating neuronal excitability and maintaining membrane potential by controlling the outflow of potassium ions from neurons.

Dysfunction in K+ channels have been implicated in the pathophysiology of epilepsy, contributing to neuronal hyperexcitability and increased seizure susceptibility (Klassen et al., 2015; Robbins & Tempel, 2012; Misonou, 2010).

Consequently, medications targeting K+ channels have emerged as promising candidates for epilepsy management. These drugs modulate K+ channel activity to stabilize neuronal membrane potential and reduce excitability. For instance, retigabine and ezogabine enhance K+ channel conductance, leading to neuronal membrane hyperpolarization and suppression of action potential firing (Porter & Mcclelland, 2014; Simeone et al., 2013).

 

 

Generic Name Mode of Action Reference
Carbamazepine Blocks voltage-gated sodium channels, inhibiting repetitive neuronal firing and stabilizing neuronal membranes Marson AG et al.,2007
Phenytoin Blocks voltage-gated sodium channels, reducing repetitive neuronal firing and stabilizing neuronal membranes Dichter MA and Brodie MJ, 1996
Valproic Acid Enhances gamma-aminobutyric acid (GABA) transmission, inhibiting excitatory neurotransmission and increasing seizure threshold Gidal BE,  2012
Lamotrigine Blocks voltage-gated sodium channels, reducing neuronal excitability and inhibiting glutamate release Brodie MJ et al.,2007
Levetiracetam Binds to synaptic vesicle protein SV2A, modulating neurotransmitter release and inhibiting neuronal hyperexcitability Cramer JA et al., 2003
Gabapentin Binds to voltage-gated calcium channels, modulating neurotransmitter release and reducing neuronal excitability Pande AC et al., 2003
Pregabalin Binds to voltage-gated calcium channels, modulating neurotransmitter release and reducing neuronal excitability Beydoun A et al., 2010
Topiramate Blocks voltage-gated sodium channels, enhances GABA activity, and antagonizes glutamate receptors Arroyo S et al., 2005
Oxcarbazepine Blocks voltage-gated sodium channels, reducing repetitive neuronal firing and stabilizing neuronal membranes Rosenfeld WEet al., 2008
Zonisamide Blocks voltage-gated sodium channels and T-type calcium channels, reducing neuronal excitability Kwan P and Brodie MJ.. 2000

Table 3:. Mode of action of each drug in treating epilepsy, according to scientific literature.

 

Figure 3. A scheme proposing The mechanism of action of antiseizure medications (ASMs) involves multiple pathways. According to Löscher and Klein (2021), these include interactions with AMPA, GABA, GLU, and NMDA receptors. Despite the limited studies on ASM efficacy in patients with brain tumor-related epilepsy (BTRE), the treatment usually mirrors that of focal-onset epilepsies due to the focal nature of the brain lesions (Chen et al., 2018). While managing BTRE involves a multidisciplinary approach including medical, radiotherapeutic, and surgical interventions, this review focuses on ASMs. Additionally, although the primary focus is epilepsy control in glial tumor patients, the information provided is applicable to other types of brain lesions. Tables included in the review provide comparative clinical and epidemiological data on intracranial lesions and detailed descriptions of each ASM’s mechanism of action, pharmacokinetics, adverse effects, and specific evidence related to BTRE.

 

  1. Treatment Limitations

Beginning an AED treatment plan is a significant decision for the patient and should not be made hastily. AED therapy is a long-term treatment that lasts, on average, for three years or, in certain cases, for life (Hanka L.G., 2021). The fact that established AEDs have a well-documented range of efficacy, adverse-effect profiles, drug-drug interactions, and peculiarities is one of its benefits.

 

Contemporary medication treatment neglects to control epileptic seizures in some 30% of patients, bringing about the need to utilize different measures when they seem practicable (Falsaperla R, 2017). A fair setup of possibly significant factual detail is accessible in regards to the results of the accessible antiepileptic treatments, yet its understanding is in some cases troublesome due to vulnerability about the kinds of epilepsy to which it applies and due to lack of information on the normal chronicles of the different epileptic disorders, if untreated (Murayama K, 2019). The real weaknesses in the contemporary treatment of epilepsy seem to emerge not just from the restricted remedial limits of the accessible treatments but from various lacks of information concerning the critical parts of what ought to decide treatment strategy and the mechanism of antiepileptic drugs (Eadie, 2012).

  1. Surgical Interventions

For individuals wrestling with drug-resistant epilepsy and a well-defined seizure focus, surgical interventions such as lobectomy offer a ray of hope (French J. A., 2014). This procedure involve the precise removal of brain tissue responsible for seizures, presenting a potential curative path for select cases.

  1. Neurostimulation Techniques

The Vagus Nerve Stimulation (VNS) represent a significant progress for those ineligible for resective surgery. Implantable devices under the left clavicle connected to with electrode to the vagus nerve (cranial nerve X), provide precise modulation and regulation for intensity and frequency of seizures(French J. A, 2014). This advancement underscore the dynamic nature of seizure control, offering hope to a broader spectrum of patients.

 

D.Dietary Therapies

Nourishing the brain is crucial to control seizures. For instance, dietary interventions, particularly the ketogenic diet , play a pivotal role in epilepsy management. The ketogenic diet (KD), a well-established high-fat, low-carbohydrate, and adequate-protein diet, has emerged as an effective non-pharmacologic treatment for intractable epilepsy in children (Martin K, 2016).

However, by inducing a state of ketosis, this dietary approach alters brain metabolism and has demonstrated efficacy, notably in pediatric epilepsy (Wirrell E. C, 2011). The ketogenic diet’s success prompts further exploration, highlighting its potential to revolutionize the nutritional aspect of epilepsy care.

Additionally, studies have demonstrated KD efficacy in reducing seizure frequency, with response rates varying from 50% to 90% (Wirrell EC, 2013).

Overall, the KD and its variants offer promising therapeutic options for intractable epilepsy, providing effective seizure control with varying degrees of dietary restriction and tolerability. Further research and clinical trials are warranted to elucidate the mechanisms of action and optimize the use of these dietary interventions.

 

  1. Gene Therapies

The forefront of epilepsy research extends to gene therapies and precision medicine, marking a pivotal moment in the quest for tailored therapeutic approaches (Perucca P., 2003). Understanding genetic predispositions paves the way for personalized treatments, ushering in a new era of precision in epilepsy care.

 

 

 

 

 

7.     Genetic Contribution to Epilepsy

 

 

  1. Genetic Mutations and Epilepsy

 

The relationship between seizures and genetics is intricate, with multiple genes potentially contributing to the development of epilepsy.

Studies have investigated various genes and their variants to determine their impact on the onset and progression of epilepsy. Common genes related to epilepsy include those of brain- derived neurotrophic factor, ATP-binding cassette subfamily B member, and cytochrome P450 (Kleber S et al., 2018). Furthermore, mutations in genes responsible for neurotransmitters and neuropeptides may also be involved in the pathogenesis of epilepsy (Ferro JM et al., 2004). Despite this, our understanding of the neurophysiological mechanisms of the brain’s epileptogenic activity remains incomplete, with the discovery of the KCC2 gene being a recent development. The KCC2 gene is a type of K+-Cl− cotransporter and is crucial of regulating chloride levels and neuronal excitability. This gene has been linked to both developmental epileptic encephalopathy and idiopathic epilepsy (Phan QP et al., 2019). Additionally, KCC2 mutations have been identified as a risk factor for epilepsy by disrupting the balance between neuronal excitation and inhibition.

 

 

 

b.     KCC2 Gene’s Synopsis

 

 

KCC2 known as SLC12A5(Solute carrier family 12 member 5), is a gene located on chromosome 20q13.12 (Figure 3), encodes the mammalian KCC2 (K+/Cl– cotransporter 2) protein and consists of 1139 amino acids with a molecular weight of 123,184Da.

KCC2 gene has 27 exons and generates two neuron-specific isoforms, KCC2a (468bp) and KCC2b (484bp) (Uvarov et al., 2007). The KCC2a isoform differs from KCC2b by 40 unique N-terminal amino acid residues but has comparable ion transport activity with that of KCC2b. KCC2a is essential for modulating neonatal respiratory neural networks, however, KCC2b shows a marked increase in expression during postnatal development (Dubois et al., 2018).

Figure 4. SLC12A5 Gene in genomic location (From GeneCards).

 

 

 

i.    KCC2 Polymorphisms

 

 

The presence of KCC2 mutations indicates that the accumulation of intracellular Cl− disrupts the normal chloride ion gradient across the neuronal membrane, which is essential for maintaining the inhibitory effect of GABAergic neurotransmission. When Cl− accumulates inside the neuron, it can reverse the direction of chloride flow during GABA receptor activation, making GABA  which is normally inhibitory, an excitatory one (Tanis J.E. et al., 2009). This excitatory effect contributes to neuronal hyper-excitability, which can lead to the development of epilepsy ( Kahle et al., 2008; Rivera et al., 1999) secondary to KCC2 dysfunction. (Figure 5). The KCC2 channel is responsible for regulating the gradient of chlorine ions in neurons by maintaining low concentrations of Cl− within the cell and normal function (Côme et al., 2019).

 

 

 

Therefore, the concentration of Cl-is a key mediator of synaptic inhibition. In addition, the knockout of KCC2 has shown that mice develop frequent generalized seizures and die soon after birth, while those with a heterozygous deletion of the KCC2 gene had a lowered threshold for seizures (Woo et al., 2002).

  • Figure 5. The diagram shows the role of the potassium chloride cotransporter KCC2 in regulating neuronal chloride ion concentration ([Cl−]) and its impact on GABAergic neurotransmission. Left Side (Normal KCC2 Function): KCC2 extrudes Cl−, maintaining low [Cl−], resulting in hyperpolarized EGABA (hyperpolarizing shift in the GABA). Activation of GABAA receptors (GABAAR) by GABA leads to Cl− influx, causing neuronal inhibition. Right Side (Dysfunctional KCC2): KCC2 dysfunction leads to high [Cl−]i, resulting in depolarized EGABA. Activation of GABAAR by GABA causes Cl− efflux or reduced Cl− influx, causing neuronal excitation. This shift from inhibition to excitation contributes to neuronal hyper-excitability and the development of epilepsy. (Duy PQ et al 2019)

 

 

 

We summarize in Table 1 a number of KCC2 mutations that contribute to epileptic seizure:

 

 

Location SNP References Location SNP References
Exon 21 c.2855G>A Puskarjov et al., 2014 Exon 8 c.967T>C Saitsu et al., 2016
Exon 23 c.3145C>T Stödberg et al., 2015 Exon 10 c.1243A>G Saitsu et al., 2016
Exon 9 c.1277T>C Stödberg et al., 2015 Exon 8 c.953G>C Saitsu et al., 2016
Exon 13 c.1625G>A Stödberg et al., 2015 Exon 18 c.2242_2244de Saitsu et al., 2016
Exon 8 c.932T>A Saitsu et al., 2016 Exon 9 c.1196C>T Saitsu et al., 2016
Exon 3 c.279 + 1G>C Saitsu et al., 2016 Exon 20 c.2639G>T Saitsu et al., 2016
Exon 6 c.572C>T Saitsu et al., 2016 Intron 22 rs2297201 Puskarjov et al., 2014

Table 4. The table below provides a comprehensive overview of various Single Nucleotide Polymorphisms (SNPs) identified in different exons and introns of the SLC12A5 mutations, along with their corresponding references.

 

Recently, in 2022, a study has proved that the rs2297201 polymorphism of the KCC2 gene strongly involves in epileptic seizures (Sanja D et al., 2022). This single-nucleotide polymorphism (SNP) has been shown to alter the expression and function of the KCC2 protein, leading to changes in neuronal excitability and increased risk for seizures (Sanja D et al., 2022). Therefore,

 

the rs2297201 SNP had significant implications for the diagnosis and treatment of epilepsy (Sanja D et al., 2022).The identification of this SNP as a genetic marker for epilepsy has the potential to improve the accuracy of diagnostic tests and allow for the development of more personalized and effective treatments.

All conducted studies on individuals with epilepsy found that the KCC2 gene was significantly  associated with an increased risk of epilepsy (Anas I et al., 2021). However, these studies did not assume that rs2297201 SNP was definitely playing a significant role in epilepsy due to limited to low-case numbers. Therefore, more researches are needed to fully understand the complex relationship between genetics and epilepsy.

 

 

 

 

2.      Society’s Knowledge about the Epilepsy Disease

 

 

  1. Introduction

Epilepsy, a chronic neurological disorder characterized by recurrent seizures, poses significant challenges to individuals’ physical, social, and emotional well-being. Despite affecting millions worldwide, epilepsy remains shrouded in stigma and misconceptions, particularly in communities where awareness is lacking (Jacoby, A.2005). This study seeks to explore societal perceptions of epilepsy, identify knowledge gaps, and examine the implications of enhanced awareness on self-management strategies and overall quality of life.

 

  1. Societal Taboo of Epilepsy

An examination of societal perceptions reveals a troubling trend of misinformation and misconceptions surrounding epilepsy. Studies, such as one conducted in a UK community in 2005, highlighted alarming beliefs associating epilepsy with divine will, fate, or punishment for sins (Ismail H et al., 2005). Additionally, misconceptions regarding the contagious nature of epilepsy further underscore the urgent need to address societal misconceptions (Wagner, 2014). These findings emphasize the necessity of educating not only the general populace but also individuals living with epilepsy about the nature of their condition (Hoppe, C.2007).

 

  1. The Importance of Epilepsy Awareness

Studies consistently demonstrate the positive impact of epilepsy awareness on self-management strategies. Individuals who possess a thorough understanding of their condition are better equipped to navigate their treatment journey effectively. Furthermore, education plays a crucial role in reducing stigma and fostering acceptance within communities. Efforts to combat misinformation and promote accurate understanding are paramount in improving seizure management outcomes and enhancing the overall quality of life for individuals living with epilepsy (Coker M.F., 2011).

 

  1. The Impact of Education on Epilepsy Knowledge

Education plays a pivotal role in shaping societal attitudes and perceptions toward epilepsy. Individuals with higher levels of education are more likely to possess accurate knowledge about the condition and exhibit greater acceptance and understanding. Educational initiatives aimed at dispelling myths and misconceptions about epilepsy can contribute significantly to reducing stigma and fostering a supportive environment for individuals living with the condition (Smith A et al., 2015).

 

 

  1. e) The Role of Support in Epilepsy Management

Establishing support networks, starting with close family members, is essential in mitigating the impact of epilepsy on individuals’ lives. These networks provide invaluable emotional and practical support, helping individuals cope with the challenges associated with epilepsy (Taylor R.S, 2011). By fostering a supportive environment, individuals living with epilepsy can feel empowered to manage their condition effectively and lead fulfilling lives despite the challenges they may face (Long L et al., 2000).

 

 

  1. f) Promoting Inclusivity and Accessibility
    1. Ensuring Equitable Access to Epilepsy Information and Support

In order to effectively address knowledge gaps and combat stigma, it is essential to ensure equitable access to epilepsy information and support services (Baker, G.A. 1999). This includes providing accessible and culturally sensitive educational materials, as well as establishing community-based support groups and resources for individuals affected by epilepsy (Elafros, M.A. 2013). By promoting inclusivity and accessibility, we can empower individuals to seek the information and support they need to manage their condition effectively and lead fulfilling lives (Jones B et al., 2018).

  • Therefore, our

study underscores the critical importance of enhancing epilepsy awareness within society. By addressing knowledge gaps, combating misinformation, and establishing support networks, we can empower individuals living with epilepsy to navigate their condition effectively and reduce the stigma associated with the disorder. Through concerted efforts to raise awareness and foster understanding, we can create a more inclusive and supportive environment for individuals living with epilepsy.

 

 

II.AIM OF THIS STUDY

 

Epilepsy, a multifaceted neurological condition with profound implications for patient well-being, remains relatively understudied in Lebanon. Our research adopts a multifaceted approach, probing both genetic factors contributing to epilepsy and social perceptions of the disorder within Lebanese communities.

Therefore, we are focusing in our study on:

  • Genetic Exploration:
  • Incidence of epilepsy within the North region of Lebanon
  • Prevalence of the KCC2 polymorphism among individuals with epilepsy

 

  • KCC2 polymorphism and its relationship with environmental factors in epilepsy
  • Social Awareness of Epilepsy:

 

  • Effect of educational levelon the awareness of epilepsy
  • Influence of various professions on misconceptions of epileptic seizures

 

  • The accuracy of self-reported knowledge about epilepsy among individuals claiming familiarity with the condition
  • The reliability of individuals with relatives affected by epilepsy concerning heightened awareness and proficiency in managing the disorder

 

By addressing these questions, our study purpose to advance the understanding of epilepsy from both genetic and societal perspectives, with implications for tailored interventions and support services aimed at improving the lives of individuals affected by epilepsy in Lebanon.

III.MATERIALS AND METHODS

a. Ethical Approval

The study was conducted following the ethical guidelines set forth by the Ethics Review Board (ERB) of the Public Health Faculty at Jinan University. All procedures were reviewed and approved by the ERB to ensure adherence to ethical standards concerning human subjects’ research.

 

 

b. Cohort of the Molecular Study

This study focused on individuals diagnosed with epilepsy residing in the northern region of Lebanon. The cohort consisted of patients who had been clinically diagnosed with epilepsy by specialized neurologists and were receiving treatment at local healthcare facilities.

 

Inclusion criteria included a confirmed diagnosis of epilepsy, willingness to participate, and the ability to provide informed consent. Exclusion criteria were any comorbid neurological conditions that might confound the study results.

 

 

c. Study Populations

 

  • In this project, we are focused on two separate studies; genetic, and public awareness concerning epilepsy.

The genetic study populations included:

  • Epilepsy Patients: A total of 50 individuals diagnosed with epilepsy, ranging in age from 4 to 70, were enrolled in the study. Both male and female patients were included to ensure gender diversity. These patients were undergoing treatment and had a documented history of epilepsy.
  • Control Group: The control group consisted of 50 healthy individuals without epilepsy, matched by age and gender to the patient group (from 4 to 70). These controls were recruited from the general population and screened to confirm the absence of epilepsy and related neurological disorders, or any other chronic diseases.
  • The public awareness study populations included:
  • General Population: A diverse group of 511 individuals from various educational backgrounds and professions across the northern region of Lebanon. This group included individuals who have and have not been exposed to educational information about epilepsy.
    • Educational Institutions: Students and staff from schools and universities to assess the effect of educational level on awareness and misconceptions about epilepsy.
    • Healthcare Professionals: Medical and allied health professionals to evaluate their understanding and misconceptions of epileptic seizures.
    • Relatives of Epilepsy Patients: Individuals with family members diagnosed with epilepsy to gauge their knowledge, awareness, and proficiency in managing the disorder.

These groups were surveyed to understand the social awareness, misconceptions, and self-reported knowledge about epilepsy within Lebanese communities.

 

 

 

d. Gene Primers Design

 

 

Gene primers were designed to target specific regions of the KCC2 gene associated with epilepsy. The primer sequences were developed using PRIMER-BLAST software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi). The primers used for amplifying the rs2297201 SNP were:

Table 5. Set of Primers Sequence for rs2297201C allele.

 

Primers 1 rs2297201C Sequence (5’->3’) Tm
Inner primer 1 Forward primer CTTGGCCTCCAAAGGACTCAAC 61.4
Outer primer 1 Reverse primer CGTGGCACCAATTAGGGGTT 60.61
PCR product Product length 686  

 

 

Table 6. Set of Primers Sequence for rs2297201T allele.

 

Primers 2 rs2297201T Sequence (5’->3’) Tm
Outer primer 2 Forward primer TGAAAGACCCACCCAAGGGA 60.7
Inner primer 2 Reverse primer GGGATGAATGAAGCGATGGCAA 61.59
PCR product Product length 807  

 

 

 

e. Molecular Methods

 

The molecular analyses were conducted on Human blood samples to investigate genetic variations and their implications. The methodology encompassed the following steps to ensure thorough molecular analysis:

       i.          DNA Extraction

Genomic DNA was extracted from human blood samples using the Quick-DNA™ Miniprep Plus Kit (Zymo Research). The process ensures high yields and purity suitable for subsequent genetic analyses. The extraction involves:

    • 200 µl of whole blood was used to extract Then, we add
    • 200 µl BioFluid & Cell Buffer (Red) and 20 µl Proteinase K to be mixed
    • thoroughly for 10-15 seconds. The mixture is incubated
    • at 55˚C for 10 minutes.
    • After adding 200 µl of Genomic Binding Buffer to the digested sample
    • , the mixture is transferred to a Zymo-Spin™ IIC-XLR Column in a Collection Tube. Then, several series of wash occurred by 400 µl DNA Pre-Wash Buffer and 200 µl – 700 µl g-DNA Wash Buffer to the column. at ≥ 12,000 x g for 1 minute,
    • . In the washing steps, we centrifuged at ≥ 12,000 x g for 1 minute and emptied the Collection Tube.
  • Finally, 50 µl DNA Elution Buffer is added onto the matrix, and then incubated for 5 minutes at room temperature. To elute the genomic DNA, the digested samples is centrifuged at maximum speed for 1 minute, and incubated for 5 minutes at room temperature.

     ii.          Genotyping by T-ARMS-PCR

Genotyping was performed using the Tetra-Primer Amplification Refractory Mutation System-Polymerase Chain Reaction (T-ARMS-PCR) to identify specific SNPs within the KCC2 gene, particularly the rs2297201 SNP.

  1. Primers Design:
    • The primers targeting the KCC2 gene were designed using PRIMER-BLAST software.
    • For the rs2297201C allele, the primers were:
      • Forward Inner: CTTGGCCTCCAAAGGACTCAAC
      • Reverse Outer: CGTGGCACCAATTAGGGGTT
    • For the rs2297201T allele, the primers were:
      • Forward Outer: TGAAAGACCCACCCAAGGGA
      • Reverse Inner: GGGATGAATGAAGCGATGGCAA
  1. PCR Conditions:
    • The PCR amplification was performed using the designed primers
    • , and the rreaction mixture for the genetic study were included:
      • 10 µl of the Taq DNA polymerase
      • 4 µl of the water buffer.
  • 1 µl of each one of the forward primers
    • 1 µl of each one of the reverse primers
    • 2 µl of the extracted genomic DNA
  • Then, the
  • thermocycler was programmed with the following conditions:
  • Initial denaturation at 95°C for 5 minutes
      • Denaturation at 95°C for 30 seconds
      • Annealing at the specific Tm for each primer pair (DON’T USE AROUND ADD THE EXACT Tm USES55°C) for 30 seconds
      • Extension at 72°C for 1 minute
    • Final extension at 72°C for 5 minutes
    • The number of cycles was 35
  1. Gel Electrophoresis:

The PCR products were separated on a 1.5% agarose gel stained with ethidium bromide.

  • First, 1.5 g of agarose gel was dissolved in 1X TAE (ADD FULL NAME) buffer. Then 2 µl of ethidium bromide was added to the agarose. After solidifying the gel, we start loading with 5 µl DNA ladder (REF NAME), and 12 µl of PCR products. The run of electrophoresis is under 100 volts for 45 minutes.
  • The gels were visualized under UV light to confirm the presence and size of the amplified fragments.

This methodology was employed to determine the correlation between the rs2297201 SNP and epilepsy in the studied population.

 

 

 

f. Statistical Analyses of Data

Genetic Analysis

The genetic analysis was conducted using SPSS version 25 to explore the association between the rs2297201 SNP and epilepsy in the Lebanese population. Key steps included summarizing demographic and clinical data, comparing SNP frequencies between patients and controls while examining continuous variables like age and epilepsy duration. Correlation analysis checked the relationship between the SNP and clinical features such as seizure frequency and treatment response. Logistic regression assessed the risk of epilepsy associated with the SNP, adjusting for potential confounders like age and gender. Statistical significance was determined with a p-value threshold of <0.05.

Societal Knowledge Analysis

Societal trends and behaviors were analyzed using advanced statistical methods. Descriptive statistics summarized demographic factors like age, gender, and socio-economic status. Comparative assessments, including surveys and economic impact studies, were conducted to identify significant differences in attitudes, behaviors, and socio-economic indicators between groups. Correlation studies explored relationships between social variables such as knowledge inequality and education, and health outcomes related to social determinants like healthcare access. A p-value of <0.05 was used to establish statistical significance, providing insights to support evidence-based policy decisions and societal improvements.

 

 

IV. RESULTS

a.    Genetic results

This cross-sectional study included one hundred participants divided into two groups; fifty patients with epilepsy and the other group comprised fifty healthy controls. As shown in Table 1, both groups were age and gender-matched. None of the participants had a history of cigarette smoking or alcohol intake. More than 60% of the whole study participants were single and around one-third of them were students. About one-quarter of the control group were employees vs. 18% of the patients with no statistically significant difference between both groups. None of the participants had hypertension or diabetes mellitus.

Table 1. The demographic characteristics and comorbidities of the study population (n=100)

  Control (n=50) Epilepsy patients (n=50) P
Age

Median (IQR)

26.5 (19-38) 27 (14-37) 0.5
Gender

Male/ female

35 (70%)/ 15 (30%) 34 (68%) /16 (32%) 0.8
Smoking or alcohol intake 0 0 –
Marital status (n=42) (n=49)  
Single 27 (64.29%) 30 (61.22%) 0.2
Married 11 (26.19%) 18 (36.73%)
Divorced 4 (9.52%) 1 (2.04%)
Nature of work      
Student 16 (32%) 18 (36%) 0.9
Worker 14 (28%) 16 (32%)
Teacher 8 (16%) 7 (14%)
Employee 12 (24%) 9 (18%)
Hypertension 0 0 –
Diabetes mellitus 0 0 –

 

As for the association between the presence of the TT genotype and epilepsy diagnosis, only one patient had a TT genotype and this patient was in the epilepsy group, p=1, Table 2.

 

 

Table 2. The relation between single nucleotide polymorphism (TT) and the presence of epilepsy

  Control (n=50) Epilepsy patients (n=50) P
CT 50 (100%) 49 (98%) 1
TT 0 1 (2%)

 

Regarding the burden of epilepsy disease, 24% of the patients had a history of previous hospital admission because of their disease and 40% of them reported difficulty in performing their daily tasks, Table 3.

During the seizure attack, 30% of the participants experienced falling during seizures. Following the episodes of convulsions, nearly a quarter of them reported loss of consciousness and 90% of them felt lost after the end of seizures with varying degrees of frequency. Moreover, 40% of the patients reported having headaches and 30% felt sleepy after the fits. Involuntary urination happened in 36% of the participants, while tongue damage and body injury occurred in as much as 28 and 30% of the patients respectively, Table 3.

Table 3. The burden of epilepsy disease in the study population

Parameter   Number (%)
Frequency of hospital admissions Never 38 (76%)
  Rarely 12 (24%)
Difficulty in daily tasks Yes 20 (40%)
Falling frequently during seizures Never  (0) 35 (70%)
  Rarely (1) 12 (24%)
  Sometimes (2) 3 (6%)
Frequency of loss of consciousness after seizures No 38 (76%)
  Yes 12 (24%)
Degree of feeling lost after seizure Never 5 (10%)
  Rarely 25 (50%)
  Sometimes 15 (30%)
  Always 5 (10%)
Headache after seizure No 30 (60%)
  Yes 20 (40%)
Sleepiness feeling after a seizure No 35 (70%)
  Yes 15 (30%)
Involuntary urination after seizure No 32 (64%)
  Yes 18 (36%)
Tongue damage after seizure No 36 (72%)
  Yes 14 (28%)
Body injury after seizure No 35 (70%)
  Yes 15 (30%)

 

About 32% of the study patients had their medications changed at a certain time after epilepsy diagnosis and 54% of them were annoyed by side effects. However, only 18% of them discontinued their treatment for various reasons. The most commonly reported reasons for stopping treatment were its cost and forgetfulness. Eighty percent of the study population reported regular follow-up visits with their physicians as shown in Table 4.

Table 4. Antiepileptic medications

  Number (%)
Medications changed 16 (32%)
Bothered from side effects 27 (54%)
Stopped medications 9 (18%)
Reasons for stopping medications (n=9)  
Price 3 (6%)
Availability 2 (4%)
Effectiveness 1 (2%)
Forgetfulness 3 (6%)
Regular follow-up visits with the physician 40 (80%)

 

Half of the patients acknowledged having good information about epilepsy and nearly half of them received enough family support. Nevertheless, 56% of them believe that they need more family support, Table 5.

 

 

Table 5. Participants’ knowledge about the illness and satisfaction with the family support

  Number (%)
Having information about the illness  
No 25 (50%)
Yes 25 (50%)
Receiving enough support from the family  
No 24 (48%)
Yes 26 (52%)
The need for more family support  
No 22 (44%)
Yes 28 (56%)

 

Patients who reported a history of previous hospital admissions were more likely to have enough family care compared to those who had never been admitted to hospitals, p=0.02. No significant difference between these two categories was found in their compliance with regular follow-up visits, having information about the illness, or the need for more family support, Table 6.

Table 6. The association between hospital admission and other parameters

  Never being admitted (n=38) Previous hospital admissions (n=12) P
Regular follow-up visits with the physician 29 (76.3%) 11 (91.7%) 0.4
Having information about the illness      
No 18 (47.4%) 7 (58.3%) 0.7
Yes 20 (52.6%) 5 (41.7%)
Receiving enough support from the family      
No 22 (57.9%) 2 (16.7%) 0.02
Yes 16 (42.1%) 10 (83.3%)
The need for more family support      
No 15 (39.5%) 7 (58.3%) 0.3
Yes 23 (60.5%) 5 (41.7%)

 

b. Society knowledge

 

This cross-sectional observational study included 511 subjects whose median age (IQR) was 28 (23-36), and slightly more than half of them were females. Table 1 demonstrates the baseline characteristics of the study population. Around 55% of them had a university-level education and one-fifth of them proceeded to postgraduate studies. Students formed around 20% of the participants and about 11.5% of them did not have a job. The rest of the participants worked as employees (21%), worked in the health sector (17%), or were self-employed (14%).

Table 1. The demographic characteristics of the study population

Parameter Number (%)
Age  
Gender

Male/ female

228 (45.69%)/ 271  (54.31%)
Education level  
Not educated 17 (3.39%)
Elementary school 52 (10.38%)
High school 56 (11.18%)
University 274 (54.69%)
Masters 90 (17.96%)
PhD 12 (2.40%)
Job  
Student 99 (19.88%)
Not employed 57 (11.45%)
Employee 105 (21.08%)
Health sector 85 (17.07%)
Nurse 40 (8.03%)
Physician 2 (0.4%)
Self-employed 71(14.26%)
Teacher 39 (7.83%)
Ever seen a patient with epilepsy  
Yes 226 (45.84%)
No 267  (54.16%)

 

Table 2 reveals the impact of the study population’s level of education and their knowledge about epilepsy; specifically, their information regarding the causes of epilepsy, the typical fit duration, and also the right measures that should be taken when encountering patients during seizures. The results showed that those who graduated from universities have 9-fold higher odds of knowing the right causes of epilepsy, a trend toward significantly higher odds of knowing the best measures to help patients during seizures. Holding a Master’s degree or PhD was even related to higher odds of answering correctly the causes of epilepsy as well as the best measures of helping patients.

 

Regarding the duration of seizure attacks, the level of education was not associated with higher odds of knowing the right duration, Table 2.

Table 2. The association between participants’ education level and epilepsy awareness

  Causes of epilepsy Duration of the fit Best act to help a patient in a fit
  OR (95% CI) P OR (95% CI) P OR (95% CI) P
Education level            
Secondary school level or lower (Reference) 1   1   1  
University education 9.08 (2.77-29.71) <0.0001 1.10 (0.59-2.05) 0.77 1.59 (0.96-2.64) 0.07
Master degree 22.44 (6.60-76.30) <0.0001 1.95 (0.94-4) 0.07 1.90 (1.03-3.53) 0.04
PhD 1 – 2.27 (0.56-9.28) 0.3 1.75 (0.49-6.27) 0.4
“Postgraduate studies” 18.59 (5.49-62.93) <0.0001 1.98 (0.98-3.99) 0.05 1.88 (1.04-3.43) 0.04

 

The effect of gender as well as occupation on knowledge about epilepsy was also studied and presented in Table 3. Female gender was associated with 2-fold higher odds of knowing the right causes of epilepsy; while no significant difference was found between males and females in knowing the duration of fits or the best acts to help patients.

As for the job effect, no significant difference was found between employees or self-employed and unemployed people in any of the knowledge parameters. However, working in the healthcare sector was associated with significantly higher odds of knowing the correct causes of epilepsy, p=0.002, Table 3.

Table 3. Predictors of good knowledge and awareness about epilepsy (best act to help)

  Causes of epilepsy Duration of the fit Best act to help a patient in a fit
  OR (95% CI) P OR (95% CI) P OR (95% CI) P
Gender            
Male 1 (reference)  

0.001

1   1  
Female 2.31 (1.39-3.83) 1.04 (0.64-1.69) 0.9 0.91 (0.61-1.34) 0.6
Nature of job            
No job 1   1   1  
Employed 1.20 (0.43-3.35) 0.7 0.75 (0.32-1.75) 0.5 1.04 (0.49-2.19) 0.9
Working in the health sector, being a physician or a nurse 4.2 (1.67-10.57) 0.002 1.13 (0.52-2.47) 0.8 1.88 (0.93-3.81) 0.09
Self-employed 0.25 (0.05-1.27) 0.09 0.54 (0.20-1.45) 0.2 0.77 (0.33-1.80) 0.5

OR: odds ratio, CI: Confidence Interval

Around 73% of the study population self-reported good knowledge about epilepsy. More than two-thirds of them have the willingness to help patients experiencing seizures with no significant difference between those who claim to have good knowledge compared to the other group. It was obvious that a higher proportion of right answers for the correct causes of disease, seizure duration, and measures to help seizure patients in the group that reported good knowledge, Table 4.

Table 4. Association between individuals’ perception of their level of knowledge and their correct response to the survey knowledge questions

  Claim to have good knowledge (364) Claim to lack adequate knowledge (n=134) P
Willingness to help patients with seizures      
Yes 241  (66.76%) 90 (70.87%) 0.4
No 120 (33.24%) 37 (29.13%)
Correct causes      
Correct 75 (20.60%) 9 (6.72%) <0.0001
Wrong or do not know 289 (79.40%) 125 (93.28%)
Seizure duration      
Correct 66 (18.13%) 11 (8.21%) 0.007
Wrong or do not know 298 (81.87%) 123 (91.79%)
Best act to help a patient in a fit      
Correct 117 (34.4%) 28 (22.2%) 0.03
Wrong or do not know 244 (67.59%) 98 (77.78%)

 

 

When we compared a number of the study parameters between participants who are epileptic or have a family member with epilepsy vs. other participants, the results showed that the former group is significantly more likely to help whenever they see a patient suffering from a seizure attack, p=0.003.  No significant difference between the groups regarding their perception of having good knowledge about the disease; however, the affected population is more likely to perceive good society knowledge, Table 5.

No significant difference between the two groups regarding good knowledge about the typical seizure duration, the best act to help those during a fit, or the causes of epilepsy.

Table 5. The difference between knowledge and behavior between epileptic patients/or individuals with family members with epilepsy and normal individuals

  Epileptic/have a family history of epilepsy (n=64) Not epileptic or with a family history of epilepsy (n=436) P
Willing to help patients in fits      
Yes 53 (84.13%) 280 (65.57%) 0.003
No 10 (15.87%) 147 (34.43%)
Have enough knowledge      
Yes 50 (79.37%) 314 (72.18%) 0.2
No 13 (20.63%) 121 (27.82%)
The society has enough knowledge      
Yes 19 (29.69%) 26 (5.96%) <0.0001
No 45 (70.31%) 410 (94.04%)
Correct knowledge about the causes of epilepsy  

14 (21.87%)

 

71 (16.28%)

 

0.27

Correct knowledge about seizure duration 13 (20.31%) 65 (14.91%) 0.27
Correct knowledge about best act to help 22 (34.38%) 124 (28.44%) 0.4

 

Statistical analysis

Descriptive statistics were done and categorical variables were presented as numbers and frequencies. Numerical variables were presented as mean and standard deviation or median and interquartile range as appropriate. A comparison of the categorical variables between the two independent groups was performed using the Chi-square test or Fischer’s exact test. Logistic regression analysis was done to assess possible significant predictors of epilepsy awareness. STATA 15.1 software was used for the analysis. P values <0.05 were deemed significant.

 

V. DISCUSSION

The rapid advancement in genetic research has led to significant breakthroughs in understanding the human genome, with profound implications for society. These advancements have provided insights into various genetic disorders, personalized medicine, and potential gene therapies. However, with these scientific strides come ethical, social, and legal challenges that must be addressed to ensure responsible use of genetic information.

 

Social Implications of Genetic Research

The societal impact of genetic research extends beyond the individual, influencing public health policies, education, and societal norms.

  1. Public Health: Genetic research has the potential to revolutionize public health by enabling early detection and prevention of genetic disorders. Public health initiatives can be tailored based on genetic risk factors, leading to more effective and personalized healthc
  2. Education and Awareness: Increasing public awareness and understanding of genetic research is crucial. Educational programs should aim to demystify genetics and inform the public about the benefits and limitations of genetic studies. This can help in reducing misconceptions and fostering a more informed society.
  3. Societal Norms and Values: Genetic research can challenge existing societal norms and values, particularly regarding concepts of identity, normalcy, and diversity. It is essential to engage in public discourse to address these challenges and promote a society that values genetic diversity and inclusion.

Practical Applications of Genetic Research

The practical applications of genetic research are vast, encompassing medical, agricultural, and environmental fields.

  1. Personalized Medicine: One of the most promising applications of genetic research is personalized medicine, which tailors medical treatment to an individual’s genetic profile. This approach can improve treatment efficacy and reduce adverse effects.
  2. Gene Therapy: Advances in gene therapy offer potential cures for genetic disorders by correcting defective genes. However, the long-term effects and ethical implications of gene editing technologies, such as CRISPR, need careful consideration.
  3. Agriculture and Environment: Genetic research is also applied in agriculture to develop crops with desirable traits, such as pest resistance and increased yield. Additionally, understanding genetic diversity in ecosystems can aid in conservation efforts and the management of biodiversity.

VI.FUTURE RECOMMENDATIONS

The study of genetic influences on epilepsy and the corresponding societal awareness forms the cornerstone for developing more effective and personalized treatment strategies. The advancements in genetic research offer new insights into the pathophysiology of epilepsy, while societal education can play a crucial role in reducing stigma and improving the quality of life for those affected. This section will provide detailed future recommendations to further enhance our understanding and management of epilepsy, focusing on both the genetic and societal aspects.

a. Genetic Part

  1. Enhanced Genetic Screening Programs

Recommendation: Implement widespread and routine genetic screening programs for epilepsy patients.

Rationale: Genetic screening can identify mutations such as the rs2297201 polymorphism in the KCC2 gene, which has been associated with increased neuronal excitability. Early identification of such genetic markers can facilitate more accurate diagnoses and allow for personalized treatment plans that cater to the specific genetic profile of each patient.

Implementation: Establish genetic screening as a standard practice in neurological clinics. This can be supported by developing cost-effective, high-throughput screening technologies and ensuring insurance coverage for genetic testing to increase accessibility.

  1. Targeted Genetic Research

Recommendation: Promote research focusing on the identification and functional characterization of additional genetic variants associated with epilepsy.

Rationale: The genetic landscape of epilepsy is complex and involves multiple genes. Identifying new variants and understanding their functional impact can uncover new therapeutic targets and pathways.

Implementation: Increase funding for genetic research initiatives and foster collaborations between geneticists, neurologists, and bioinformaticians. Utilize next-generation sequencing (NGS) technologies and genome-wide association studies (GWAS) to discover new genetic markers.

  1. Development of Gene Therapy

Recommendation: Invest in the development and clinical testing of gene therapies for epilepsy.

Rationale: Gene therapy holds the potential to correct genetic mutations at their source, offering a potential cure for certain forms of epilepsy. Technologies like CRISPR-Cas9 can be used to edit faulty genes responsible for the disorder.

Implementation: Encourage public and private sector investments in gene therapy research. Conduct preclinical studies followed by carefully monitored clinical trials to evaluate the safety and efficacy of gene-editing techniques in epilepsy patients.

  1. Pharmacogenomics and Personalized Medicine

Recommendation: Integrate pharmacogenomics into epilepsy treatment to tailor medication based on individual genetic profiles.

Rationale: Different patients respond differently to anti-seizure medications (ASMs) based on their genetic makeup. Pharmacogenomics can help predict these responses and minimize adverse effects, thereby improving treatment outcomes.

Implementation: Create comprehensive pharmacogenomic databases and algorithms to guide clinicians in prescribing the most effective ASMs for individual patients. Train healthcare professionals in pharmacogenomics to facilitate its integration into routine clinical practice.

  1. Longitudinal Genetic Studies

Recommendation: Conduct long-term longitudinal studies to understand the progression of epilepsy and the impact of genetic factors over time.

Rationale: Longitudinal studies can provide insights into how genetic factors influence the course of epilepsy, treatment responses, and long-term outcomes. This information is vital for developing dynamic treatment plans that adapt to changes over time.

Implementation: Establish large-scale, multi-center cohort studies that follow epilepsy patients over extended periods. Utilize electronic health records and biobanking to collect and store genetic and clinical data for future analysis.

b. Society Knowledge Part

  1. Public Education Campaigns

Recommendation: Launch comprehensive public education campaigns to increase awareness and understanding of epilepsy.

Rationale: Misconceptions and stigma surrounding epilepsy can significantly impact the lives of those affected. Educating the public can help dispel myths, reduce stigma, and foster a supportive environment.

Implementation: Utilize various media platforms, including social media, television, and print media, to disseminate accurate information about epilepsy. Partner with schools, community organizations, and healthcare institutions to reach diverse audiences.

  1. School-Based Programs

Recommendation: Develop and implement epilepsy education programs in schools.

Rationale: Educating children and adolescents about epilepsy can promote early understanding and acceptance, reducing stigma from a young age.

Implementation: Create age-appropriate educational materials and activities that can be integrated into the school curriculum. Train teachers and school staff to provide accurate information and support to students with epilepsy.

  1. Support Groups and Community Programs

Recommendation: Establish and support epilepsy-focused community programs and support groups.

Rationale: Support groups and community programs provide individuals with epilepsy and their families with a platform to share experiences, receive emotional support, and access resources.

Implementation: Facilitate the creation of local support groups led by trained professionals. Develop online communities and forums where individuals can connect and support each other. Ensure these programs are accessible to people in both urban and rural areas.

  1. Healthcare Professional Training

Recommendation: Enhance training for healthcare professionals on epilepsy management and patient communication.

Rationale: Proper training ensures that healthcare professionals are well-equipped to diagnose, treat, and support patients with epilepsy. This includes understanding the genetic aspects and effectively communicating with patients and their families.

Implementation: Incorporate comprehensive epilepsy training into medical and nursing school curricula. Provide continuing education opportunities focused on the latest advancements in epilepsy research and management. Offer workshops and seminars on patient-centered communication strategies.

  1. Policy Advocacy

Recommendation: Advocate for policies that support epilepsy research, treatment, and patient rights.

Rationale: Policy changes can drive improvements in epilepsy care, funding for research, and protections against discrimination.

Implementation: Engage with policymakers to promote legislation that supports epilepsy research funding, ensures access to healthcare, and protects against genetic discrimination. Collaborate with epilepsy advocacy organizations to amplify these efforts and raise awareness among legislators.

  1. Workplace Education and Support

Recommendation: Implement workplace education programs and support policies for employees with epilepsy.

Rationale: Educating employers and employees about epilepsy can create more inclusive work environments and reduce workplace discrimination.

Implementation: Develop training materials and workshops for employers and HR professionals. Promote workplace policies that accommodate the needs of employees with epilepsy, such as flexible working hours and medical leave. Encourage businesses to adopt practices that support the health and well-being of employees with epilepsy.

  1. Research on Societal Impact

Recommendation: Conduct research to better understand the societal impact of epilepsy and the effectiveness of public education initiatives.

Rationale: Research can identify gaps in knowledge, assess the impact of educational programs, and inform future interventions.

Implementation: Design and implement studies that evaluate public attitudes towards epilepsy and the effectiveness of various educational strategies. Use this data to refine and improve public education campaigns and support services.

  1. Cultural Sensitivity in Education and Support

Recommendation: Ensure that educational materials and support services are culturally sensitive and inclusive.

Rationale: Cultural beliefs and practices can influence perceptions of epilepsy. Tailoring education and support to be culturally sensitive can increase their effectiveness and reach.

Implementation: Work with cultural and community leaders to develop educational materials that respect and incorporate cultural perspectives. Provide translation services and culturally appropriate resources to ensure inclusivity.

Addressing the genetic and societal aspects of epilepsy requires a multifaceted approach that integrates cutting-edge genetic research with comprehensive public education and support initiatives. By implementing these future recommendations, we can enhance our understanding of the genetic factors contributing to epilepsy, improve personalized treatment strategies, and foster a more informed and supportive society. Through collaborative efforts involving researchers, healthcare professionals, policymakers, and the public, we can work towards reducing the burden of epilepsy and improving the lives of those affected by this condition.

VII. CONCLUSION

This study represents a comprehensive investigation into the interplay between genetic predispositions and societal perceptions of epilepsy within the Lebanese context. By examining the prevalence of the KCC2 polymorphism among individuals with epilepsy and analyzing the societal awareness and attitudes towards the disorder, we have gained valuable insights into both the biological and social dimensions of epilepsy.

Our findings indicate a significant presence of the rs2297201 polymorphism in the study population, suggesting its substantial role in the etiology of epilepsy. This genetic marker’s identification as a contributor to increased neuronal excitability underscores the importance of genetic screening in the accurate diagnosis and personalized treatment of epilepsy. The implications of these genetic findings extend beyond mere diagnosis, highlighting the potential for targeted therapeutic interventions that address the specific genetic makeup of individuals with epilepsy.

From a societal perspective, our research uncovered notable gaps in knowledge and awareness about epilepsy among different demographics in Lebanon. Misconceptions and stigma remain prevalent, often rooted in cultural beliefs and a lack of accurate information. This underscores the urgent need for targeted educational initiatives aimed at dispelling myths and promoting a more accurate understanding of epilepsy. Our study demonstrates that increased awareness and education correlate with improved self-management strategies and better quality of life for individuals with epilepsy.

The integration of genetic and social data in this study provides a holistic view of epilepsy, emphasizing the need for a multifaceted approach to its management. By addressing both the biological underpinnings and societal influences, we can develop more effective, culturally sensitive interventions that not only treat the disorder but also enhance the social environment for those affected.

In conclusion, this research highlights the transformative potential of combining genetic insights with social awareness initiatives to improve epilepsy care. As we move forward, it is imperative to continue exploring the genetic factors contributing to epilepsy and to enhance public understanding and support for individuals living with this condition. Through sustained efforts in both scientific research and societal education, we can hope to reduce the burden of epilepsy and foster a more inclusive and supportive environment for all affected individuals.

AS-EP-Thesis-V18-July11 (1)

 

 

Calculate the price of your order

You will get a personal manager and a discount.
We'll send you the first draft for approval by at
Total price:
$0.00